AQA A-level Biology: Species, Taxonomy and Investigating Diversity (7402)

This guide covers AQA A-level Biology (7402) sections 3.4.5, Species and taxonomy, and 3.4.7, Investigating diversity, as set out in the AQA AS and A-level Biology specification for first teaching 2015. Both belong to topic 4. That is AS content, and the A-level papers that assess topics 1 to 4 can also test it. Section 3.4.6 is not covered here. Use the revision notes for recall and the practice questions to test yourself. Course pages: AQA A-level Biology hub and the printable checklist. To find weak spots first, try the free diagnostics. The sequences and data below are invented for teaching.

What the specification asks for

Section	What you must be able to do
3.4.5	Define a species; explain courtship and its role in species recognition; describe a phylogenetic hierarchy; name the taxa from domain to species; write a binomial; appreciate how immunology and genome sequencing clarify relationships
3.4.7	Compare characteristics, DNA, mRNA and protein sequences; interpret sequence data to suggest relationships; appreciate the change from inferring DNA differences to reading DNA directly; use random samples; interpret a mean and its standard deviation

The specification says you do not need to recall different taxonomic systems, such as the three domain or five kingdom systems. It also says knowledge of gene technologies will not be tested, and that you will not be required to calculate standard deviations in written papers. Interpreting them is required.

3.4.5 Species

Two organisms belong to the same species if they are able to produce fertile offspring. Both words matter. A pairing that produces no offspring, or offspring that cannot themselves breed, does not show membership of one species. If the offspring are fertile, the parents’ genes can pass into the next generation and mix in a shared gene pool.

Limits of this definition are worth knowing even though the specification gives only the definition. It cannot be tested on organisms that only reproduce asexually, or on fossils, because breeding cannot be observed.

Courtship behaviour

Courtship behaviour is a pattern of actions by one or both partners before mating. The specification states two points.

• It is a necessary precursor to successful mating. Mating does not start until the partner has responded correctly.
• It plays a role in species recognition.

Courtship is usually species specific. Males of one firefly species, for example, flash in a particular pattern, and females respond only to their own species’ pattern. An animal that responds only to the correct signal avoids wasting gametes and energy on a mating that would give no offspring, or sterile ones. Courtship can also show that a partner is sexually mature and ready to mate.

3.4.5 Phylogenetic classification

A phylogenetic classification system arranges species into groups based on their evolutionary origins and relationships. It uses a hierarchy: smaller groups sit inside larger groups, and there is no overlap between groups. Each group is a taxon (plural taxa).

The hierarchy in the specification has eight taxa, listed here from the broadest group down:

domain, kingdom, phylum, class, order, family, genus, species

Each taxon contains one or more taxa from the rank below. Species in the same genus share a more recent common ancestor than species that share only a family.

Taxon	European robin	Lion	Domestic cat
Domain	Eukarya	Eukarya	Eukarya
Kingdom	Animalia	Animalia	Animalia
Phylum	Chordata	Chordata	Chordata
Class	Aves	Mammalia	Mammalia
Order	Passeriformes	Carnivora	Carnivora
Family	Muscicapidae	Felidae	Felidae
Genus	Erithacus	Panthera	Felis
Species	rubecula	leo	catus

Read the table downwards to see the nesting. Read it across to compare. The lion and domestic cat share every taxon down to family, so they are more closely related than either is to the robin, which differs from them at class.

Binomials

Every species is identified worldwide by a binomial made of the name of its genus and then its species, for example Homo sapiens. The rules are fixed.

• The genus name has a capital letter. The species name has none.
• Both are in italics. In handwriting, underline each word separately.
• The pair is the species name. The second word alone is not.

Panthera leo is correct. Panthera Leo, panthera leo and “leo” are not. A binomial is useful because it is universal, so scientists in different countries use the same name even if their common names differ, and because the genus tells you something about relationships.

Immunology and genome sequencing

You must appreciate that advances in immunology and genome sequencing help to clarify evolutionary relationships.

• Immunology. Species with similar proteins have similar antigens. Antibodies made against a protein from one species bind more strongly to the same protein in a close relative than in a distant one. Stronger binding suggests that the protein is more similar and the species are more closely related.
• Genome sequencing. Reading the base sequences of whole genomes gives a large amount of data that can be compared directly. Two species whose sequences are very similar probably shared a common ancestor recently.

These methods can overturn classifications based on appearance. Whales and dolphins look very different from hippopotamuses, but DNA evidence indicates that hippopotamuses are their closest living relatives. Organisms can resemble each other because they live in similar ways rather than because they are closely related, so appearance alone can mislead.

3.4.7 Comparing genetic diversity

Genetic diversity within a species, or between species, can be investigated by comparing four things:

1. the frequency of measurable or observable characteristics
2. the base sequence of DNA
3. the base sequence of mRNA
4. the amino acid sequence of the proteins encoded by that DNA and mRNA.

Gene technology has changed the method. Before, differences in DNA were inferred from characteristics that could be seen or measured. Now the DNA sequence can be investigated directly. You do not need to know the technologies.

Frequency of characteristics

Worked example. A wildflower grows on two meadows. In a random sample of 150 plants from each meadow, 63 plants from meadow 1 and 117 plants from meadow 2 have hairy stems.

Meadow 1: 63 / 150 x 100 = 42.0 %
Meadow 2: 117 / 150 x 100 = 78.0 %

The characteristic is much more frequent in meadow 2, so the populations may differ genetically. The inference is weak: stem hairiness may also be affected by the environment, such as wind or grazing, and the characteristic is controlled by only part of the genome. Direct DNA comparison avoids both problems.

Comparing sequences

Suppose the same gene is sequenced in four species. The first 24 bases of the coding strand are:

A  ATGGCTAAACGTTCAGGTCATGAC
B  ATGGCTAAACGTTCAGGACATGAC
C  ATGGCAAAGCGTTCCGGACATGAT
D  ATGACAAAGAGTTCCGTACGTGAT

Count the positions that differ for each pair and convert to a percentage of 24.

Pair	Bases different	Percentage different
A and B	1	4.2 %
A and C	5	20.8 %
A and D	9	37.5 %
B and C	4	16.7 %
B and D	8	33.3 %
C and D	4	16.7 %

Interpretation. The fewer the differences, the more recently two species probably shared an ancestor, because mutations accumulate over time. A and B are most similar, C is the next closest, and D is the most different from all three. This suggests that A and B are closely related and D is the most distant. Two populations of one species can be compared in the same way: a small number of differences between them shows genetic diversity within the species.

DNA, mRNA and protein

The same gene can be compared at three levels, and they do not give identical answers. Translate the first 24 bases of each sequence, using the standard genetic code, into eight amino acids.

A  Met-Ala-Lys-Arg-Ser-Gly-His-Asp
B  Met-Ala-Lys-Arg-Ser-Gly-His-Asp
C  Met-Ala-Lys-Arg-Ser-Gly-His-Asp
D  Met-Thr-Lys-Ser-Ser-Val-Arg-Asp

Species A, B and C have different DNA but identical amino acids, because the genetic code is degenerate and a base change can leave the amino acid unchanged. Only D differs, at 4 of 8 positions (50 %). Therefore:

• DNA sequences are the most sensitive comparison. They detect changes that do not alter the protein.
• Protein sequences show only changes that altered an amino acid, so closely related species can look identical.
• An mRNA sequence is the complement of the template strand, with uracil in place of thymine, and shows the bases that are actually translated. Comparing mRNA tells you about the coding sequence only, whereas DNA also includes non-coding regions.

A short sequence gives a weak conclusion. Real comparisons use long sequences and many genes.

3.4.7 Quantitative investigation of variation

A quantitative investigation of variation within a species involves three steps:

1. collect data from random samples
2. calculate a mean and the standard deviation of that mean
3. interpret the mean values and standard deviations.

Random sampling

A sample is random when every individual or position has an equal chance of being chosen. This removes the bias of choosing “typical” or easily reached individuals. To sample a 20 m by 30 m field:

1. Lay one tape along each of two adjacent sides.
2. Use a random number generator to produce a pair of numbers, one from 0 to 20 and one from 0 to 30, for example (7.3, 21.8).
3. Place the sampling point at that position, record, and repeat.
4. Collect enough samples to reduce the effect of chance.

To investigate the effect of position on leaf growth, number the leaves on a shrub and choose leaves with random numbers, rather than picking the leaves that are easiest to reach.

Mean and standard deviation

The mean is the average. The standard deviation measures how spread out the values are around the mean. A small value means the data are clustered close to the mean. A large value means they are widely spread. You only need to interpret it.

Worked example. Seed pod length (cm), 40 pods from each of three sites:

Site	Mean	Standard deviation	Mean minus 1 s.d. to mean plus 1 s.d.
1	8.4	0.6	7.8 to 9.0
2	9.1	0.7	8.4 to 9.8
3	8.5	1.9	6.6 to 10.4

• Site 2 has the longest mean pods.
• Site 3 is the most variable, because its standard deviation is the largest.
• Sites 1 and 3 have similar means but different spread, so the mean alone hides the difference.
• The ranges for sites 1 and 2 overlap (8.4 to 9.0), so the difference between them may be due to chance. Judging this properly needs a statistical test, which is beyond this section.

For data that follow a normal distribution, about 95 % of values lie within two standard deviations of the mean.

Common errors

• Writing “offspring” without “fertile” in a definition of species.
• Writing a binomial without italics or underlining, or capitalising the species word.
• Saying a taxon overlaps another. Taxa nest; they do not overlap.
• Saying that identical protein sequences mean identical DNA.
• Calling appearance enough evidence of relatedness.
• Saying a larger standard deviation means a larger mean.

Official syllabus

This guide follows sections 3.4.5 and 3.4.7 of the AQA AS and A-level Biology specification (7401 and 7402) for first teaching 2015, published by AQA.