OxfordAQA International AS and A-level Biology: Regulation of gene expression and stem cells (9610) – Practice Questions

These are original questions written for Marlbridge, for revision and practice on this content. They are not reproduced past-paper questions, and they do not replicate the exam’s exact structure, question count or mark tariffs – examination boards hold copyright in their own papers. Use these alongside the official past papers from your board or school.

These questions cover section 3.4.9 of the OxfordAQA International AS and A-level Biology (9610) specification, Version 5.1 (Unit 4, Control): epigenetic control, oncogenes and tumour suppressor genes, RNA interference and stem cells. Use the study guide and revision notes first. Course pages: hub and checklist. Weak areas? Try the free diagnostics.

Questions

1. Define an epigenetic change, and explain why increased methylation of DNA is not classed as a gene mutation. [3]

2. Explain how increased methylation of a promoter and decreased acetylation of histones can each reduce the expression of a gene. [4]

3. Gene R is a tumour suppressor gene. Promoter methylation and mRNA from gene R were measured in four tissue samples.

Sample	Promoter sites methylated (%)	Gene R mRNA (arbitrary units)
Healthy tissue	5	80
Benign growth	9	76
Early tumour	68	9
Advanced tumour	74	5

(a) Calculate how many times higher methylation is in the advanced tumour than in healthy tissue, and the percentage fall in mRNA between healthy tissue and advanced tumour. [3] (b) State two conclusions the data support. [2] (c) Describe an experiment to test whether methylation causes the fall in mRNA. [2]

4. A drug stops acetyl groups being removed from histones. Cells were treated with it. Histone acetylation near gene W rose from 1.0 to 2.8 relative units and mRNA from gene W rose from 120 to 330 copies per cell.

(a) Calculate the percentage increase in mRNA copies. [1] (b) Explain the rise in mRNA. [3] (c) Suggest one reason this drug might cause side effects. [1]

5. Explain how a mutation in a proto-oncogene and a mutation in a tumour suppressor gene can each lead to the formation of a tumour. [4]

6. In one cancer, the promoter of tumour suppressor gene P is hypermethylated and the promoter of oncogene Q is hypomethylated. Explain how each change contributes to uncontrolled cell division. [4]

7. In a long-term study, 126 of 840 people with a harmful variant of a tumour suppressor gene developed a cancer. In a group of 5,600 people without the variant, 224 developed the cancer.

(a) Calculate the percentage of each group that developed the cancer, and the risk ratio. [3] (b) Suggest two ways a person found to carry the variant could reduce their risk. [2] (c) Give one limitation of using this result to predict an individual’s future health. [1]

8. Mice with a tumour driven by an overactive oncogene were given a drug that blocks its protein. The tumour was 0.20 cm³ at the start. After 21 days the mean volume was 1.45 cm³ in the control group and 0.62 cm³ in the treated group.

(a) Calculate the percentage increase in tumour volume in each group. [2] (b) Calculate how much smaller the treated tumours were than the controls after 21 days, as a percentage of the control volume. [1] (c) Explain how blocking the oncogene’s protein slows tumour growth. [2]

9. A section of mRNA reads 5′ GGCUAAGCUUACCGAUUCGA 3′. A researcher designs an siRNA to bind to it. Cells without siRNA contained 3,200 copies of this mRNA. Cells with it contained 480 copies.

(a) Write the sequence of the part of the siRNA that pairs with this mRNA, in the same left-to-right order as the mRNA. [2] (b) Explain how the siRNA reduces the amount of the protein made. [3] (c) Calculate the percentage decrease in mRNA copies and explain why the gene is not fully switched off. [2]

10. A miRNA of 22 nucleotides pairs with 17 bases of a target mRNA and has 5 mismatches.

(a) Calculate the percentage of its bases that pair. [1] (b) Compare how a miRNA and an siRNA bind to mRNA and the effect each can have. [3] (c) Suggest why one miRNA can affect the activity of several different genes. [2]

11. (a) Distinguish between totipotent and pluripotent cells. [2] (b) Name one example of a multipotent cell and one example of a unipotent cell, stating what each forms. [2] (c) Explain why specialised cells translate only part of their DNA. [2]

12. A stem cell treatment was tested for a degenerative disorder. 150 patients received the treatment and 150 received a standard treatment. After a year, 96 treated patients and 54 controls had improved.

(a) Calculate the percentage of each group that improved and the difference. [2] (b) Evaluate stem cells as a treatment for human disorders, using this trial and other knowledge. [6]

Answers

1. An epigenetic change alters gene function [1] without altering the DNA base sequence, and it is preserved when cells divide [1]. Methylation adds methyl groups but no base is lost, added or replaced, so the sequence is unchanged [1]. [3] Examiner insight: A bare statement that methylation “switches genes off” does not explain why it is not a mutation. Name what stays the same: the base sequence.

2. Methylation: a methylated promoter is harder for transcription factors and RNA polymerase to bind [1], so less mRNA is made [1]. Acetylation: with fewer acetyl groups, histones attract DNA more strongly [1], so DNA is tightly packed and the gene cannot be transcribed easily [1]. [4] Examiner insight: Mention histone charge and attraction to DNA; answers that stop at “DNA is tighter” are weaker.

3. (a) 74 / 5 = 14.8 times [1]. Fall in mRNA = (80 − 5) / 80 × 100 [1] = 93.75%, about 93.8% [1]. (b) Higher methylation of the promoter is associated with lower mRNA from gene R [1]. The tumours have higher methylation and lower expression than healthy tissue [1]. (c) Treat tumour cells with a drug that removes methylation (and keep untreated cells as a control) [1]. Measure mRNA from gene R in both; a rise in mRNA after treatment supports methylation as the cause [1]. [7] Examiner insight: Show the sum. In (b), keep to what the data show: association, not proof of cause, which is why (c) is asked.

4. (a) (330 − 120) / 120 × 100 = 175% [1]. (b) More acetyl groups remain on the histones [1]. The attraction between histones and DNA is weaker, so DNA is looser [1]. RNA polymerase and transcription factors reach the promoter more easily, so more transcription occurs [1]. (c) The drug acts on histones throughout the body, so it may increase expression of genes that should stay off in healthy cells [1]. [5] Examiner insight: Write a chain of cause and effect, not a list of separate facts.

5. Proto-oncogene: a mutation makes the protein overactive or too abundant [1], so the cell is signalled to divide when it should not, giving uncontrolled division [1]. Tumour suppressor gene: a mutation makes its protein non-functional [1], so division is not slowed, damaged DNA is not repaired and damaged cells do not undergo apoptosis [1]. [4] Examiner insight: State each gene’s normal role before describing the effect of its mutation, and keep the two cases separate.

6. Gene P: hypermethylation lowers transcription [1], so less tumour suppressor protein is made and the brakes on division are lost [1]. Gene Q: hypomethylation increases transcription of the oncogene [1], so too much of the protein stimulating division is made [1]. [4] Examiner insight: The changes act in opposite directions on the genes but give the same result for the cell. Say “increased” or “decreased” transcription for each gene.

7. (a) 126 / 840 × 100 = 15.0% [1]. 224 / 5,600 × 100 = 4.0% [1]. Risk ratio = 15.0 / 4.0 = 3.75 [1]. (b) Two from: more frequent screening so cancer is found early; preventive surgery; lifestyle changes to reduce other risk factors [1] [1]. (c) Most carriers (85%) did not develop the cancer, so a result shows risk and not certainty [1]. [6] Examiner insight: Link each suggestion to the higher risk given in the data.

8. (a) Control: (1.45 − 0.20) / 0.20 × 100 = 625% [1]. Treated: (0.62 − 0.20) / 0.20 × 100 = 210% [1]. (b) (1.45 − 0.62) / 1.45 × 100 = 57.2% [1]. (c) The oncogene protein signals cells to divide [1]. Blocking it lowers the division rate, so the tumour grows more slowly [1]. [5] Examiner insight: In (b) the question says a percentage of the control, so the control volume is the divisor.

9. (a) Complement of each base (A with U, G with C): CCGAUUCGAAUGGCUAAGCU [2]. (b) The siRNA joins a protein complex [1]. It binds by complementary base pairing to the mRNA [1]. The mRNA is broken down, so less is translated and less protein is made [1]. (c) (3,200 − 480) / 3,200 × 100 = 85% [1]. Some mRNA remains, because not every molecule is destroyed, so the gene is knocked down, not deleted [1]. [7] Examiner insight: Write U not T and check the length matches the target. State that siRNA acts on mRNA, not DNA.

10. (a) 17 / 22 × 100 = 77.3% (77%) [1]. (b) siRNA is fully complementary to its target mRNA, while miRNA is often only partly complementary [1]. siRNA typically leads to breakdown of the mRNA [1]. miRNA can block translation or lead to breakdown, so gene activity can change [1]. (c) Pairing need not be perfect [1], so one miRNA can bind to several mRNAs with similar sequences [1]. [6] Examiner insight: Put both molecules in each comparison point, using “whereas” or “but”.

11. (a) Totipotent cells can form every cell type, including a whole organism [1]. Pluripotent cells form many cell types, but not a whole organism [1]. (b) Multipotent: a bone marrow cell that forms blood cells [1]. Unipotent: a cell that forms only one type, such as a muscle satellite cell, which forms muscle fibres [1]. (c) Different genes are expressed in different cell types [1]. Only the genes needed for that cell’s function are transcribed and translated, and the rest of the DNA is not translated [1]. [6] Examiner insight: Describe potency by what each cell can form, and make examples match the named type.

12. (a) Treated: 96 / 150 × 100 = 64.0%; control: 54 / 150 × 100 = 36.0% [1]. Difference = 28.0 percentage points [1]. (b) For: a large difference between groups, with equal group sizes [1]; stem cells can replace damaged tissue and may avoid donor shortages [1]; the patient’s own cells reduce rejection [1]. Against or limits: 36% of controls also improved, so other factors may contribute [1]; long-term safety, such as tumour risk, is not shown by a one-year trial [1]. Ethical objections apply if embryos are used, and cost may limit access [1]. Judgement: a real benefit is suggested, but longer follow-up is needed. [8] Examiner insight: Evaluate means weighing evidence both ways, then reaching a judgement. Quote figures from the data.

Where marks are usually lost

• Calling methylation a mutation, or saying it changes the base sequence.
• Mixing up which gene is switched off (tumour suppressor) and which is over-activated (oncogene).
• Writing T instead of U when pairing bases with mRNA.
• Saying siRNA acts on DNA, or removes the gene.
• Using the wrong baseline in a percentage change.
• Treating correlation in methylation data as proof of cause.
• Giving only advantages of stem cell therapy, or no judgement.

Next steps

• Return to the revision notes and the study guide.
• Course hub and checklist.
• Take the free 10-minute diagnostics.
• Book a free trial class.

Official syllabus

OxfordAQA, International AS and A-level Biology (9610), Version 5.1, section 3.4.9 (3.4.9.1 to 3.4.9.3). Check oxfordaqa.com/9610 for the current specification.