OxfordAQA International AS and A-level Biology: Regulation of gene expression and stem cells (9610)

This guide covers section 3.4.9 of the OxfordAQA International AS and A-level Biology (9610) specification, Version 5.1: 3.4.9.1 epigenetic control of how genes are expressed, 3.4.9.2 RNA interference and 3.4.9.3 stem cells. The specification headline for 3.4.9 is “Regulation of transcription and translation”. It sits in Unit 4, Control, which is International A2 content; Units 1 and 2 make up the International AS. For quick recall use the revision notes, then test yourself with the practice questions. Course pages: hub and checklist. If you are unsure where your gaps are, take a free diagnostic. Earlier cancer content is in cell division, mutation and cancer.

What the specification asks for

Section	What you must be able to do
3.4.9.1 Epigenetics	Explain that epigenetic changes alter gene function without changing the base sequence and are kept when cells divide; link them to increased DNA methylation and decreased histone acetylation
3.4.9.1 Cancer	Explain how faulty methylation of tumour suppressor genes and of oncogenes helps cancer develop; interpret information on using these genes in prevention and treatment
3.4.9.2 RNA interference	Describe how miRNA and siRNA attach to the mRNA of target genes and raise or lower their activity
3.4.9.3 Potency	State that, as totipotent cells specialise, only some of their DNA is translated; distinguish totipotent, pluripotent, multipotent and unipotent cells
3.4.9.3 Evaluation	Weigh up benefits and risks of stem cell treatments for human disorders and reach a judgement

Epigenetic control (3.4.9.1)

Every body cell of an individual has the same DNA, yet a neurone and a liver cell make different proteins. One reason is that genes can be switched down or up without any change to the order of bases. An epigenetic change alters gene function without altering the DNA base sequence. It is preserved when the cell divides, so daughter cells keep the same pattern of gene activity. The specification links epigenetic change to two events.

Increased methylation of DNA. Methyl groups are added to DNA, commonly to cytosine bases in the control region (promoter) of a gene. The base sequence is unchanged, which is why methylation is not a mutation. Heavy methylation of a promoter lowers transcription, because the gene is harder for the transcription machinery to use. The pattern is copied when DNA replicates, so it is passed to daughter cells.

Decreased acetylation of histones. DNA is wound round histone proteins. Histones are positively charged and DNA is negatively charged, so they attract. Adding acetyl groups to histones reduces the attraction. The DNA loosens, and transcription factors and RNA polymerase can reach the gene. Decreased acetylation does the reverse: DNA is held tightly, access is restricted and transcription falls.

Change	Effect on DNA packing	Effect on transcription
Increased DNA methylation	Gene harder to access	Decreased
Decreased histone acetylation	Tighter wrapping	Decreased
Increased histone acetylation	Looser wrapping	Increased

Both changes are reversible, which matters for treatment.

Worked example 1: methylation in colon tissue

Gene TS1 is a tumour suppressor gene. Samples from three tissues gave:

Tissue	Promoter CpG sites methylated (%)	TS1 mRNA (arbitrary units)
Normal lining	7	52
Polyp	31	21
Carcinoma	78	4

Methylation in carcinoma compared with normal: 78 / 7 = 11.1 times higher. The fall in mRNA from normal to carcinoma is (52 − 4) / 52 × 100 = 92.3%. The polyp is part-way on both measures (mRNA down 59.6%).

Conclusion: as methylation rises, mRNA falls, so higher methylation is associated with lower expression of TS1. This is a correlation. To show methylation is the cause you need an intervention. Carcinoma cells were treated with a drug that stops methylation being maintained. Methylation fell from 78% to 39%, a 50% decrease, and mRNA rose from 4 to 27 units, which is 6.75 times higher. Reversing methylation restored expression, which supports a causal link.

Worked example 2: acetylation

A drug stops acetyl groups being removed from histones. Acetylation of histones near gene G rises from 100 to 240 units, an increase of (240 − 100) / 100 × 100 = 140%. mRNA from gene G rises from 15 to 66 units: 66 / 15 = 4.4 times, or a 340% increase. The explanation links the steps: more acetyl groups, weaker attraction between histones and DNA, looser DNA, more access for RNA polymerase, more transcription.

Cancer, oncogenes and tumour suppressor genes (3.4.9.1)

Cancer is uncontrolled cell division. Two groups of genes control the cell cycle.

• Proto-oncogenes normally stimulate cell division in a controlled way. A mutation, or abnormal loss of methylation, can turn one into an oncogene, which is overactive. The cell divides when it should not.
• Tumour suppressor genes slow division, repair DNA or trigger the death of damaged cells (apoptosis). If they are inactivated by mutation, or silenced by increased methylation of their promoters, the brakes are lost.

Faulty methylation therefore acts in two directions. Hypermethylation of a tumour suppressor gene switches it off. Hypomethylation (too little methylation) of an oncogene promoter switches it on too strongly. Either way, division escapes control. Several such changes usually need to accumulate in one cell lineage.

Worked example 3: why an oncogene matters

Normal cells in a culture divide every 30 hours. Cells with an overactive oncogene divide every 18 hours. Start with one cell and wait 90 hours. Normal: 90 / 30 = 3 divisions, 2³ = 8 cells. Oncogene cells: 90 / 18 = 5 divisions, 2⁵ = 32 cells. That is 4 times as many, from a modest difference in cycle length. Real tumours also lose the signals that trigger apoptosis, so cell numbers climb faster.

Using this knowledge: prevention and treatment

The specification asks you to interpret information on how understanding these genes can be used in prevention and treatment. Typical ideas:

• Prevention: testing for harmful alleles of tumour suppressor genes (for example BRCA1 and BRCA2) identifies people at higher risk. They can then choose closer screening, lifestyle changes or preventive surgery.
• Treatment: drugs can target the protein made by an overactive oncogene (for example antibodies against the HER2 receptor in some breast cancers). Other drugs reverse abnormal methylation or acetylation so that a silenced tumour suppressor gene is expressed again. Gene therapy aims to deliver a working tumour suppressor allele.
• Limits: tumours contain varied cells, so some may resist a targeted drug. Tests identify risk, not certainty.

Worked example 4: reading risk data

In a study, 190 of 1,250 carriers of a tumour suppressor gene variant developed cancer by age 70, against 320 of 6,400 non-carriers. Carriers: 190 / 1,250 × 100 = 15.2%. Non-carriers: 320 / 6,400 × 100 = 5.0%. Relative risk = 15.2 / 5.0 = 3.04, so carriers were about three times as likely to develop cancer. Most carriers (84.8%) did not. A positive result raises risk; it does not predict cancer, and the study shows association, not the mechanism.

RNA interference (3.4.9.2)

MicroRNA (miRNA) and small interfering RNA (siRNA) are short lengths of RNA, about 20 to 25 nucleotides long. They attach to mRNA made from target genes and change its activity, which is why the process is called RNA interference. Each is loaded into a protein complex, which uses the small RNA as a guide to find mRNA with a complementary sequence.

Feature	siRNA	miRNA
Pairing with mRNA	Complementary along its whole length	Often partial, with some mismatches
Typical result	mRNA is cut and broken down, so no translation	Translation is blocked or mRNA is broken down
Effect on gene activity	Decrease	Usually decrease; the specification says the activity of target genes can be increased or decreased

Because the effect depends on a matching sequence, one miRNA can affect several mRNAs, while an siRNA can be designed to hit one mRNA. This makes siRNA useful in research and as a possible therapy for diseases caused by overactive genes, including oncogenes.

Worked example 5: designing an siRNA

Target mRNA segment: AUGCCAUUGGCACGUUAGCCU. A guide strand pairs by complementary bases (A with U, G with C). Written against the mRNA in the same left-to-right order, the guide is UACGGUAACCGUGCAAUCGGA, which is 21 nucleotides. Cells without the siRNA made 18.4 units of the encoded protein and cells with it made 4.6 units. The fall is (18.4 − 4.6) / 18.4 × 100 = 75%. Some protein remains, so the gene is “knocked down”, not deleted.

Stem cells and potency (3.4.9.3)

Most of a cell’s DNA is not translated. As cells specialise, only some of their DNA is translated. Gene expression is controlled so that each cell type makes a particular set of proteins. A stem cell divides and can form specialised cells. Potency describes how many cell types it can form.

Type	Can form	Found	Example
Totipotent	Every cell type, and so a whole organism	Briefly, in early mammalian embryos	Cells of the very early embryo
Pluripotent	Many different cell types, but not a whole organism	Mature mammals	Cells that can form many tissues
Multipotent	A limited range of related cell types	Mature mammals	Bone marrow cells forming blood cells
Unipotent	One cell type only	Mature mammals	Cells that renew one tissue, such as muscle

Pluripotent, multipotent and unipotent cells are all present in mature mammals, and each can give rise to only a restricted range of cell types. Potency falls as development proceeds.

Evaluating stem cell therapy

Use a balanced structure.

• For: can replace damaged tissue; bone marrow transplants treat some blood cancers; cells from the patient’s own body avoid rejection; an alternative to scarce donor organs.
• Against and risks: using embryos raises ethical objections; dividing cells can form tumours; donated cells may be rejected; treatments are costly and long-term safety is uncertain; cells may not specialise as intended.
• Judging evidence: look at sample size, a control group, how long patients were followed and whether the effect is large.

Worked example 6: a trial

In a trial, 78 of 120 treated patients improved, against 45 of 120 controls. Treated: 78 / 120 × 100 = 65.0%. Controls: 45 / 120 × 100 = 37.5%. The difference is 27.5 percentage points. The treatment looks beneficial, but 37.5% of controls also improved, so some benefit may be a placebo or natural recovery effect. You would also want the number of patients, how they were chosen and follow-up time.

Common errors

• Calling methylation a mutation. The base sequence does not change.
• Writing that acetylation increases histone attraction to DNA. Acetylation reduces it.
• Saying a tumour suppressor gene “causes” cancer. Cancer follows when it is lost.
• Stating that siRNA destroys DNA or the gene. It acts on mRNA.
• Mixing up potency. Only totipotent cells can form a whole organism, and they exist only briefly in early mammalian embryos. Multipotent cells form a narrower range than pluripotent ones; unipotent cells form one type.
• Treating a correlation in a methylation table as proof of cause.

Official syllabus

OxfordAQA, International AS and A-level Biology (9610), Version 5.1, section 3.4.9 (3.4.9.1 to 3.4.9.3). Check oxfordaqa.com/9610 for the current specification.